|
Addgene inc
pmcherry mito 7 Pmcherry Mito 7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmcherry mito 7/product/Addgene inc Average 91 stars, based on 1 article reviews
pmcherry mito 7 - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Addgene inc
pt7 grna vector Pt7 Grna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pt7 grna vector/product/Addgene inc Average 94 stars, based on 1 article reviews
pt7 grna vector - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg Lnc Pink1 2 5 Sgrna 5 Gtgctgtggaaagaaaggagggg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg/product/Addgene inc Average 91 stars, based on 1 article reviews
lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Addgene inc
2018 n a grna cloning vector addgene 2018 N A Grna Cloning Vector Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2018 n a grna cloning vector addgene/product/Addgene inc Average 96 stars, based on 1 article reviews
2018 n a grna cloning vector addgene - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
grna expression plasmids ![]() Grna Expression Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grna expression plasmids/product/Addgene inc Average 93 stars, based on 1 article reviews
grna expression plasmids - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
dspcas9 vpr plasmid 22 vprmini ![]() Dspcas9 Vpr Plasmid 22 Vprmini, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dspcas9 vpr plasmid 22 vprmini/product/Addgene inc Average 92 stars, based on 1 article reviews
dspcas9 vpr plasmid 22 vprmini - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna sequence 5 tttgagctgtttgaggagg ![]() Guide Rna Sequence 5 Tttgagctgtttgaggagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/guide rna sequence 5 tttgagctgtttgaggagg/product/Addgene inc Average 93 stars, based on 1 article reviews
guide rna sequence 5 tttgagctgtttgaggagg - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene plasmid ![]() Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/addgene plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
130933 pb tag nicd ![]() 130933 Pb Tag Nicd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/130933 pb tag nicd/product/Addgene inc Average 90 stars, based on 1 article reviews
130933 pb tag nicd - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting control sgrnas ![]() Non Targeting Control Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control sgrnas/product/Addgene inc Average 94 stars, based on 1 article reviews
non targeting control sgrnas - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
aavs1 locus ![]() Aavs1 Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aavs1 locus/product/Addgene inc Average 94 stars, based on 1 article reviews
aavs1 locus - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
pspcas9 bb 2a puro vector ![]() Pspcas9 Bb 2a Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspcas9 bb 2a puro vector/product/Addgene inc Average 93 stars, based on 1 article reviews
pspcas9 bb 2a puro vector - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Scientific reports
Article Title: Novel gRNA design pipeline to develop broad-spectrum CRISPR/Cas9 gRNAs for safe targeting of the HIV-1 quasispecies in patients.
doi: 10.1038/s41598-019-52353-9
Figure Lengend Snippet: Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published gRNA in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of individual plasmids that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Article Snippet: All
Techniques: Derivative Assay, In Vitro, CRISPR, Cleavage Assay, Clone Assay, Amplification, Activity Assay, Plasmid Preparation