grna plasmids Search Results


91
Addgene inc pmcherry mito 7
Pmcherry Mito 7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pmcherry mito 7/product/Addgene inc
Average 91 stars, based on 1 article reviews
pmcherry mito 7 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

94
Addgene inc pt7 grna vector
Pt7 Grna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pt7 grna vector/product/Addgene inc
Average 94 stars, based on 1 article reviews
pt7 grna vector - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

91
Addgene inc lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg
Lnc Pink1 2 5 Sgrna 5 Gtgctgtggaaagaaaggagggg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg/product/Addgene inc
Average 91 stars, based on 1 article reviews
lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

96
Addgene inc 2018 n a grna cloning vector addgene
2018 N A Grna Cloning Vector Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2018 n a grna cloning vector addgene/product/Addgene inc
Average 96 stars, based on 1 article reviews
2018 n a grna cloning vector addgene - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
Addgene inc grna expression plasmids
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Grna Expression Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna expression plasmids/product/Addgene inc
Average 93 stars, based on 1 article reviews
grna expression plasmids - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

92
Addgene inc dspcas9 vpr plasmid 22 vprmini
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Dspcas9 Vpr Plasmid 22 Vprmini, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dspcas9 vpr plasmid 22 vprmini/product/Addgene inc
Average 92 stars, based on 1 article reviews
dspcas9 vpr plasmid 22 vprmini - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

93
Addgene inc guide rna sequence 5 tttgagctgtttgaggagg
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Guide Rna Sequence 5 Tttgagctgtttgaggagg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna sequence 5 tttgagctgtttgaggagg/product/Addgene inc
Average 93 stars, based on 1 article reviews
guide rna sequence 5 tttgagctgtttgaggagg - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc addgene plasmid
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/addgene plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Addgene inc 130933 pb tag nicd
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
130933 Pb Tag Nicd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/130933 pb tag nicd/product/Addgene inc
Average 90 stars, based on 1 article reviews
130933 pb tag nicd - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Addgene inc non targeting control sgrnas
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Non Targeting Control Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting control sgrnas/product/Addgene inc
Average 94 stars, based on 1 article reviews
non targeting control sgrnas - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

94
Addgene inc aavs1 locus
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Aavs1 Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aavs1 locus/product/Addgene inc
Average 94 stars, based on 1 article reviews
aavs1 locus - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Addgene inc pspcas9 bb 2a puro vector
Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published <t>gRNA</t> in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of <t>individual</t> <t>plasmids</t> that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.
Pspcas9 Bb 2a Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pspcas9 bb 2a puro vector/product/Addgene inc
Average 93 stars, based on 1 article reviews
pspcas9 bb 2a puro vector - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published gRNA in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of individual plasmids that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.

Journal: Scientific reports

Article Title: Novel gRNA design pipeline to develop broad-spectrum CRISPR/Cas9 gRNAs for safe targeting of the HIV-1 quasispecies in patients.

doi: 10.1038/s41598-019-52353-9

Figure Lengend Snippet: Figure 6. D-LTR-268145 can account for the genetic diversity of the vQS from patient-derived subtype B HIV sequences better than a previously published gRNA in a high sensitivity in vitro CRISPR/Cas9 cleavage assay. (A) LTR clones from Drexel CARES Cohort patients were amplified from PBMC genomic DNA, cloned, and sequenced. Mismatches between the D-LTR-268145 and T-LTR-237050 gRNA and the patient LTR target sites were aligned. The activity score indicated the predicted likelihood that the gRNA would cleave the target sequences with that particular mismatch or combination of mismatches. (B) In vitro CRISPR/Cas9 cleavage results of patient-derived HIV sequences representing the vQS. The number of clones in the vQS indicates the number of individual plasmids that were mixed in equal ratios. For example, patient sample A107 had 6 plasmid clones to make the vQS (clone A107-5, A107-13, A107-15, A107-16, A107-52 and A107-65) and mismatches within the target site for each clone was represented in subpanel A. Statistical significance was determined using Kolmogorov–Smirnov test and an * indicated p-values <0.05. (C) The scatter plot represents the correlation of the observed percent cleaved in the in vitro assay shown in B versus the predicted cleavage from the MIT activity score.

Article Snippet: All gRNA expression plasmids (Catalog number 53186, 53187, 53188 and 53189) and Cas9 (Catalog number 41815) were purchased from Addgene. gRNA cloning was performed as previously described with some modifications62.

Techniques: Derivative Assay, In Vitro, CRISPR, Cleavage Assay, Clone Assay, Amplification, Activity Assay, Plasmid Preparation